oSIST prEN 17882:2022

SLOVENSKI STANDARD
oSIST prEN 17882:2022
01-oktober-2022
Avtentičnost hrane - Črtno kodiranje DNK mesa in mesnih izdelkov, pridobljenih iz
sesalcev in perutnine, z uporabo segmentov genov, ki nosijo zapis za
mitohondrijski citokrom b in citokrom c oksidaze I
Food authenticity - DNA barcoding of meat and meat products derived from mammalia
and poultry using defined mitochondrial cytochrome b and cytochrome c oxidase I gene
segments
Lebensmittelauthentizität - DNA-Barcoding von Fleisch und Fleischerzeugnissen von
Säugetieren und Vögeln anhand definierter mitochondrialer Cytochrom b und Cytochrom
c Oxidase-I-Gensegmente
Authenticité des aliments - Codage à barres de l'ADN de viande et de produits carnés
dérivés de mammifères et volailles à l'aide de segments définis du gène du cytochrome
b mitochondrial et de la cytochrome c oxydase I
Ta slovenski standard je istoveten z: prEN 17882
ICS:
35.040.50 Tehnike za samodejno Automatic identification and
razpoznavanje in zajem data capture techniques
podatkov
67.020 Procesi v živilski industriji Processes in the food
industry
67.120.10 Meso in mesni proizvodi Meat and meat products
oSIST prEN 17882:2022 en,fr,de
2003-01.Slovenski inštitut za standardizacijo. Razmnoževanje celote ali delov tega standarda ni dovoljeno.

---------------------- Page: 1 ----------------------
oSIST prEN 17882:2022

---------------------- Page: 2 ----------------------
oSIST prEN 17882:2022


DRAFT
EUROPEAN STANDARD
prEN 17882
NORME EUROPÉENNE

EUROPÄISCHE NORM

July 2022
ICS 07.080; 67.020; 67.120.10
English Version

Food authenticity - DNA barcoding of meat and meat
products derived from mammalia and poultry using
defined mitochondrial cytochrome b and cytochrome c
oxidase I gene segments
Authenticité des aliments - Codage à barres de l'ADN Lebensmittelauthentizität - DNA-Barcoding von Fleisch
de viande et de produits carnés dérivés de mammifères und Fleischerzeugnissen von Säugetieren und Vögeln
et volailles à l'aide de segments définis du gène du anhand definierter mitochondrialer Cytochrom b und
cytochrome b mitochondrial et de la cytochrome c Cytochrom c Oxidase-I-Gensegmente
oxydase I
This draft European Standard is submitted to CEN members for enquiry. It has been drawn up by the Technical Committee
CEN/TC 460.

If this draft becomes a European Standard, CEN members are bound to comply with the CEN/CENELEC Internal Regulations
which stipulate the conditions for giving this European Standard the status of a national standard without any alteration.

This draft European Standard was established by CEN in three official versions (English, French, German). A version in any other
language made by translation under the responsibility of a CEN member into its own language and notified to the CEN-CENELEC
Management Centre has the same status as the official versions.

CEN members are the national standards bodies of Austria, Belgium, Bulgaria, Croatia, Cyprus, Czech Republic, Denmark, Estonia,
Finland, France, Germany, Greece, Hungary, Iceland, Ireland, Italy, Latvia, Lithuania, Luxembourg, Malta, Netherlands, Norway,
Poland, Portugal, Republic of North Macedonia, Romania, Serbia, Slovakia, Slovenia, Spain, Sweden, Switzerland, Türkiye and
United Kingdom.

Recipients of this draft are invited to submit, with their comments, notification of any relevant patent rights of which they are
aware and to provide supporting documentation.

Warning : This document is not a European Standard. It is distributed for review and comments. It is subject to change without
notice and shall not be referred to as a European Standard.


EUROPEAN COMMITTEE FOR STANDARDIZATION
COMITÉ EUROPÉEN DE NORMALISATION

EUROPÄISCHES KOMITEE FÜR NORMUNG

CEN-CENELEC Management Centre: Rue de la Science 23, B-1040 Brussels
© 2022 CEN All rights of exploitation in any form and by any means reserved Ref. No. prEN 17882:2022 E
worldwide for CEN national Members.

---------------------- Page: 3 ----------------------
oSIST prEN 17882:2022
prEN 17882:2022 (E)
Contents Page
European foreword . 3
Introduction . 4
1 Scope . 5
2 Normative references . 5
3 Terms and definitions . 5
4 Principle . 7
5 Reagents and materials . 7
5.1 General . 7
5.2 PCR reagents . 8
6 Apparatus . 8
7 Procedure . 9
7.1 Sample preparation . 9
7.2 DNA extraction . 9
7.3 PCR . 9
7.3.1 General . 9
7.3.2 PCR setup . 9
7.3.3 Temperature-time program . 10
7.3.4 PCR controls . 10
8 Evaluation . 11
8.1 Evaluation of PCR products . 11
8.2 Evaluation of the PCR results . 11
8.3 Sequencing of PCR products. 11
8.4 Evaluation of sequence data . 12
8.5 Comparison of the sequence with public databases . 12
8.5.1 General . 12
8.5.2 Sequence comparison of cytb and/or COI DNA sequences with GenBank . 12
8.5.3 Sequence comparison of COI DNA sequences with BOLD . 13
9 Interpretation of database query results . 14
10 Validation status and performance criteria . 14
10.1 Collaborative study for the identification of meat species based on cytb and COI
sequence analysis . 14
11 Test report . 18
Bibliography. 19

2

---------------------- Page: 4 ----------------------
oSIST prEN 17882:2022
prEN 17882:2022 (E)
European foreword
This document (prEN 17882:2022) has been prepared by Technical Committee CEN/TC 460 “Food
authenticity”, the secretariat of which is held by DIN.
This document is currently submitted to the CEN Enquiry.
3

---------------------- Page: 5 ----------------------
oSIST prEN 17882:2022
prEN 17882:2022 (E)
Introduction
Fraudulent adulteration of meat in food threatens both public safety and commerce. It can affect those
adhering to ethnological dietary rules, economic development and social stability. In the last three
decades, globalization has taken place in the trade of food. Meat trade channels are becoming steadily
longer and more complicated so that sophisticated traceability tools are needed to ensure food safety.
Correct food labelling is a prerequisite to ensure safe meat products and fair trade.
The development of harmonized and standardized protocols for the authentication of meat products is
necessary to establish reliable methods for the detection of potential food fraud.
4

---------------------- Page: 6 ----------------------
oSIST prEN 17882:2022
prEN 17882:2022 (E)
1 Scope
This document describes a procedure for the identification of meat and meat products derived from
mammalia and poultry to the level of genus or species.
The identification of meat species is carried out by PCR amplification of either a segment of the
mitochondrial cytochrome b gene (cytb) [1] or the cytochrome c oxidase I gene (COI) [2], or both, followed
by sequencing of the PCR products and subsequent sequence comparison with entries in databases [3],
[4]. The methodology allows the identification of a large number of frequently used as well as exotic meat
species in foodstuffs.
The decision whether the cytb or COI gene segment or both are used for meat identification depends on
the declared meat species, the applicability of the PCR method for the meat species and the availability of
comparative sequences in the public databases.
This method has been successfully validated on raw meat, however, laboratory experience is available
that it can also be applied to processed meat products.
This document is usually unsuitable for the analysis of highly processed foods with highly degraded DNA
where the fragment lengths are not sufficient for amplification of the targets. Furthermore, it is not
applicable for complex meat products containing mixtures of two or more meat species.
2 Normative references
The following documents are referred to in the text in such a way that some or all of their content
constitutes requirements of this document. For dated references, only the edition cited applies. For
undated references, the latest edition of the referenced document (including any amendments) applies.
ISO 16577, Molecular biomarker analysis — Terms and definitions
ISO 20813, Molecular biomarker analysis — Methods of analysis for the detection and identification of
animal species in foods and food products (nucleic acid-based methods) — General requirements and
definitions
3 Terms and definitions
For the purposes of this document, the terms and definitions given in ISO 16577 and the following apply.
ISO and IEC maintain terminological databases for use in standardization at the following addresses:
— IEC Electropedia: available at https://www.electropedia.org/
— ISO Online browsing platform: available at https://www.iso.org/obp
3.1
alignment
process or result of matching up the nucleotide residues of two or more biological sequences to achieve
maximal levels of identity
[SOURCE: BLAST Glossary]
5

---------------------- Page: 7 ----------------------
oSIST prEN 17882:2022
prEN 17882:2022 (E)
3.2
BLAST
Basic Local Alignment Search Tool [3]
sequence comparison algorithm optimized for speed used to search sequence databases for optimal local
alignments to a query
Note 1 to entry: It directly approximates alignments that optimize a measure of local similarity, the maximum
signal pair (MSP) score or high scoring signal pair (HSP) score.
3.3
BOLD
Barcode of Life Data Systems [4]
informatics workbench aiding the acquisition, storage, analysis, and publication of DNA barcode records
Note 1 to entry: By assembling molecular, morphological, and distributional data, it bridges a traditional
bioinformatics chasm. BOLD is freely available to any researcher with interests in DNA barcoding. By providing
specialized services, it aids the assembly of records that meet the standards needed to gain BARCODE designation
in the global sequence databases. Because of its web-based delivery and flexible data security model, it is also well
positioned to support projects that involve broad research alliances.
[SOURCE: BOLDSYSTEMS About Us]
3.4
FASTA format
text-based format for representing either nucleotide sequences or amino acid sequences, which begins
with a single-line description, followed by lines of sequence data
Note 1 to entry: The description line (defline) is distinguished from the sequence data by a greater-than (“>”)
symbol at the beginning.
EXAMPLE An example sequence in FASTA format is shown below:
> Sample_04_cytb
ATGGCCAGCCTCCGAAAAACTCATCCCCTTCTAAAGATTGCTAATGATGCATTAGTAGACCTTCCTGCCCCCTCTAACCTCT
CAACATTATGAAACTTCGGGTCTCTCCTAGGCCTCTGCTTAGCCGCCCAAATCTTAACAGGACTATTTCTAGCGATACATT
ATACCGCAAACGTCGAGATAGCTTTCTCATCCGTCGTACACATCTGCCGCGACGTAAATTACGGATGACTAATCCGCAACA
TACACGCCAACGGCGCTTCTTTCTTCTTCATCTGCCTCTACCTACACATTGCACGAGGCCTATATTACGGCTCCTACTTATT
CATAGAGACCTGAAACATTGGAGTTGTACTATTCCTTTTAGTAATAATGACCGCCTTCGTAGGCTACGTCCTCCCT
[SOURCE: BLAST topics, modified]
3.5
GenBank
comprehensive public database of e. g. genetic sequences [5]
Note 1 to entry: GenBank is part of the International Nucleotide Sequence Database Collaboration, which
comprises the DNA DataBank of Japan (DDBJ), the European Nucleotide Archive (ENA), and GenBank at National
Center for Biotechnology Information (NCBI). These three organizations exchange data on a daily basis.
6

---------------------- Page: 8 ----------------------
oSIST prEN 17882:2022
prEN 17882:2022 (E)
3.6
identity
extent to which two (nucleotide or amino acid) sequences have the same residues at the same positions
in an alignment, often expressed as a percentage
Note 1 to entry: In the database BOLD, the term similarity is used instead of identity.
[Source: BLAST Glossary]
3.7
NCBI
National Center for Biotechnology Information
institution which houses molecular biology databases (e.g. GenBank) and provides the BLAST suite
3.8
nucleotide collection
nr/nt
non-redundant database consisting of GenBank sequences, in which identical sequences have been
merged into one entry
3.9
query
sequence (or other type of search term) to which all of the entries in a data base are to be compared
[SOURCE: BLAST Glossary]
3.10
query coverage
percentage of query covered by alignment to the data base sequence
[SOURCE: BLAST help]
4 Principle
DNA is extracted from meat and meat products derived from mammalia or poultry applying a suitable
method. Segments of approximately 359 base pairs of the cytb gene and/or approximately 540 base pairs
of the COI gene are amplified by PCR. In the further course, the nucleotide sequence of the PCR product
is determined by a suitable DNA sequencing method (e.g. Sanger sequencing). The sequence is evaluated
by comparison to sequence entries in databases, thus allowing the assignment to a meat species or genus
according to the degree of identity with stored sequences.
5 Reagents and materials
5.1 General
During the analysis, unless otherwise stated, use only reagents of recognized molecular biology grade
and distilled or demineralized water or water of equivalent purity, according to ISO 20813. Regarding
laboratory organization, see ISO 20813.
7

---------------------- Page: 9 ----------------------
oSIST prEN 17882:2022
prEN 17882:2022 (E)
5.2 PCR reagents
1
5.2.1 Thermostable DNA polymerase (for hot start PCR)
1
5.2.2 PCR reaction buffer (including MgCl or with separate MgCl solution)
2 2
2

5.2.3 Deoxynucleoside triphosphate mix (dATP, dCTP, dGTP and dTTP)
5.2.4 Oligonucleotides (see Tables 1 and 2)
Table 1 — Oligonucleotides for amplification of the cytb gene region [1]
Name DNA Sequence of oligonucleotide
cytB-1 5'-CCA TCC AAC ATC TCA GCA TGA TGA AA-3'
cytB-2 5'-GCC CCT CAG AAT GAT ATT TGT CCT CA-3'
Table 2 — Oligonucleotides for amplification of the COI gene region [2]
Name DNA Sequence of oligonucleotide
CO1e-H 5'-CCA GAG ATT AGA GGG AAT CAG TG-3'
CO1f-L 5'-CCT GCA GGA GGA GGA GAY CC-3'
5.2.5 Agarose
5.2.6 Suitable DNA length standard for assessing the amplification product length
6 Apparatus
Apart from the usual laboratory equipment, the following equipment is required:
6.1 UV-spectrophotometer or fluorometer, to determine the concentration of DNA
6.2 Thermocycler
6.3 Gel electrophoresis device
6.4 Gel documentation system
6.5 DNA sequencer

1
During the collaborative study the Maxima® Hot Start PCR Master Mix (2 x) of Fermentas GmbH (ready to use
PCR buffer solution including thermostable DNA polymerase) was used for the cytb amplification and the BIOTAQ
DNA polymerase of Bioline with 10 x reaction buffer and separate MgCl solution for the COI amplification. In
2
addition to the recommended BIOTAQ DNA polymerase other mastermixes and polymerases were successfully used
in the collaborative study.
2
Deoxynucleotide triphosphates can also be part of a commercial PCR master mix.
8

---------------------- Page: 10 ----------------------
oSIST prEN 17882:2022
prEN 17882:2022 (E)
7 Procedure
7.1 Sample preparation
It should be ensured that the test portion used for DNA extraction is representative for the laboratory
sample. In composed samples (e.g. ready to use meals), single meat pieces have to be separated and
analysed. With the analysis of samples composed of several pieces, test portions for every putative meat
species are taken and analysed separately. To minimize the risk of amplifying adhering contaminants,
test sample material shall not be taken from the surface of the laboratory sample. For further information
regarding sample preparation, see ISO 20813.
7.2 DNA extraction
Concerning the extraction of DNA from the test sample, the general instructions and measures described
in ISO 21571 should be followed, see ISO 20813. It is recommended to choose one of the DNA extraction
3
methods described in ISO 21571:2005 , Annex A. Alternatively, commercial kits can be used for the
extraction and purification of DNA.
7.3 PCR
7.3.1 General
The primers used for the amplification of the section from the conserved areas of the vertebrate
mitochondrial cytb gene including a variable region are universal primers. [1].
The primers used for the amplification of the section from the mitochondrial COI gene were designed to
amplify a segment from the 5' region of the COI gene [2].
7.3.2 PCR setup
The method was validated for a total volume of 25 µl per PCR. The reagents given in Table 3 should be
used for the cytb and COI PCR, respectively.
Reagents are completely thawed at room temperature and should be centrifuged briefly before usage. A
PCR reagent mixture is prepared containing all PCR components in the given concentrations except for
the DNA extract. The amount of PCR mixture depends on the total volume per PCR and the total number
of the reactions including a sufficient pipetting reserve.
Positive PCR results are expected when using a DNA concentration of approximately 1 ng/µl reaction
solution. If it is necessary to improve the PCR result, the inserted DNA quantity may be increased (e.g. to
increase the yield of PCR product) or decreased (e.g. to avoid PCR inhibition).

3
EN ISO 21571:2005 is currently impacted by EN ISO 21571:2005/A1:2013.
9

---------------------- Page: 11 ----------------------
oSIST prEN 17882:2022
prEN 17882:2022 (E)
Table 3 — Components for the cytb and COI PCR
Reagent (stock solution) Final concentration in the reaction solution
PCR buffer 1 x
a
1,5 mmol/l
MgCl
2
a
0,2 mmol/l for each dNTP
dNTP mix
b
500 nmol/l
Forward Primer
b
500 nmol/l
Reverse Primer
Hot-start DNA Polymerase 0,5 units to 1 unit
Water Add to obtain final volume
Sample DNA About 1 ng/µl
a
Use reagent only if not already included in the PCR buffer
b
see Table 1 for cytb-PCR and Table 2 for COI-PCR
Mix the PCR reagent mixture, centrifuge briefly and split into the individual reactions. Pipette the DNA
extracts to be examined or the PCR controls (see 7.3.3) into the different reaction solutions. Transfer the
reaction setups into the thermal cycler and start the temperature-time program.
For further information on PCR controls, see also ISO 20813.
7.3.3 Temperature-time program
The temperature-time program as outlined in Table 4 has been successfully used in the collaborative
study. The use of different reagent conditions and PCR cyclers can require specific optimization. The time
for initial denaturation depends on the hot-start polymerase used.
Table 4 — Temperature-time program for the cytb resp. COI PCR
Step Parameter Temperature Time Cycles
Initial denaturation / activation
1 95 °C 15 min 1
of the hot-start polymerase
Denaturation 95 °C 40 s
2 Amplification Annealing 50 °C 80 s 35
Elongation 72 °C 80 s
3 Final elongation 72 °C 3 min 1
After the PCR is finished, store samples in the refrigerator until further analysis.
7.3.4 PCR controls
In addition to the reaction setups for the sample DNA to be analysed, an amplification reagent control
and an extraction blank control (see ISO 20813) have to be included.
A positive DNA target control (see ISO 20813) can be helpful to demonstrate the ability of the PCR to
amplify the target sequence. As positive control material, genomic DNA extracted from a known meat
species or an available plasmid containing the target sequence can be used.
If a sample shows no amplification in both targets it can be helpful to exclude an inhibition of the PCR by
performing an inhibition control reaction (see ISO 20813). This can be done either by dilution of sample
DNA or by using an internal inhibition control assay.
10

---------------------- Page: 12 ----------------------
oSIST prEN 17882:2022
prEN 17882:2022 (E)
Regarding further PCR controls, see ISO 20813.
8 Evaluation
8.1 Evaluation of PCR products
The PCR product can be assessed, and quality and quantity can be estimated, e.g. by agarose gel
electrophoresis.
Gel electrophoresis of DNA in an agarose gel is a standard technique in molecular biology. Therefore only
general conditions that need to be adapted to each laboratory are suggested.
A volume of 4 µl to 10 µl of each PCR product is separated in, for example, an agarose gel of suitable
concentration (e.g. 1 % to 2 % (w/v)) and evaluated with a gel documentation system. In one lane an
appropriate DNA size standard is included for comparison. For the cytb PCR a product of approximately
359 bp and for the coxI PCR a product of approximately 540 bp should be clearly visible after gel
electrophoresis.
No amplicons should be visible for the amplification reagent control and the extraction blank control. For
the positive DNA target control, PCR products of the expected size should be visible.
8.2 Evaluation of the PCR results
The cytb PCR and/or the COI PCR can show a positive or a negative result for amplification of the target
sequence(s).
Depending on the outcome of the PCR, the next step is to consider the following:
— If the sample is positive for one or both targets (cytb and/or COI), sequencing of one or both PCR
products should be performed as the next step (see 8.3).
— If the sample is negative for both targets, it is necessary to carry out an inhibition control (see
EN ISO 24276 and 7.3.4). If no inhibition is exhibited, it can be possible that:
— both PCR systems do not match sufficiently to the target sequence of the DNA extracted from the
meat species under analysis. In this case, species identification of the sample is not possible with
this method and analyses with further universal primer pairs (i.e. 16S rRNA primers) may follow
the tests; or
— the DNA extracted was degraded or not of sufficient quantity for PCR.
NOTE 1 For some meat species, the primer pairs of the PCR systems do not amplify the target sequences.
Examples are listed in the Barcoding Table of Animal Species [6].
NOTE 2 Further universal primer pairs are described in literature e.g. 16S ribosomal RNA gene, 12S ribosomal
RNA gene [2].
8.3 Sequencing of PCR products
Sequencing of PCR products is carried out according to the method available for the testing laboratory.
If PCR products obtained from a sample show a single band in the gel, the (remaining) PCR reaction
mixture can directly be purified using a suitable commercial kit. When more bands are present, the
appropriate band can be sliced from gel using the UV tray prior to purification.
A commonly applied standard procedure is Sanger sequencing (a cycle sequencing method) using
fluorescence-labelled dideoxynucleotides. The primers used for the generation of the amplicons serve as
sequencing primers.
11

---------------------- Page: 13 ----------------------
oSIST prEN 17882:2022
prEN 17882:2022 (E)
The DNA fragments from the sequencing reaction are subsequently separated by means of a DNA
sequencer, e.g. using capillary electrophoresis. Fluorescence signals are recorded and analysed with the
device software.
8.4 Evaluation of sequence data
The sequence trace data (or electropherogram) shall be checked visually to ensure the sequence reaction
has worked sufficiently, and basecalling is correct. Based on experience, the length of the determined
sequence should be in general approximately 80 % of the expected read length.
In case of misassigned nucleotides to chromatogram peaks, sequences have to be edited using
appropriate software and evaluating the fluorescent peak data.
A sequence analysis should be preferably performed of both DNA strands. These
complementary/overlapping sequences should be combined into a consensus sequence. This serves as
an important way of checking the accuracy of the sequence, and can help remove any ambiguous bases.
The sequences of the primers are excluded from the determined sequences before the comparison to
database sequences.
8.5 Comparison of the sequence with public databases
8.5.1 General
Cytb and/or COI DNA sequences are evaluated with regard to the taxon by comparison to sequence
entries in the nucleotide collection (nr/nt) by BLAST. For COI DNA sequences, the COI sequence database
of the Barcode of Life (BOLD) project is used in parallel.
Prior to queries in public databases, it is important to gather information about the taxon under
investigation (e.g. from NCBI taxonomy browser and/or BOLD Taxonomy section):
— additional species in the same genus;
— presence of declared and related species in GenBank and BOLD;
— amount of cytb and/or COI sequences of respective species in GenBank/BOLD.
In some cases it is also advisable to search the scientific literature for information about the grade of
genetic relation of species within a taxon.
It is recommended to use FASTA format when pasting sequences into the query boxes of BLAST and
BOLD, so that the query results are displayed together with the names of the sequences.
8.5.2 Sequence comparison of cytb and/or COI DNA sequences with GenBank
The edited cytb and/or COI DNA sequences are subjected to a comparison with sequences from the
nucleotide collection (nr/nt) of GenBank by BLAST, optimized for highly similar sequences (Megablast)
in order to identify what species the sequences originate from. The obtained matches are displayed as a
list and are sorted by default by maximum score. Before assigning a species, re-sort the hits by maximum
identity to check for inconsistencies. The hits are additionally presented as alignments with the query
sequence. In cases with more than 100 hits with ≥ 98 % identity, it is required to increase the number of
maximal target sequences (under algorithm parameters) to identify all relevant species.
The query result should be saved as pdf-file (or similar) to document the output of the database at the
time of
...